CRISPR-Cas9 and Modern Genome Editing

CRISPR-Cas9 is a genome-editing tool, adapted from a bacterial immune system, in which a guide RNA directs the Cas9 enzyme to a specific DNA sequence where it makes a double-strand cut, allowing scientists to delete, change or insert genes. In brief: the guide RNA (about 20 nucleotides) pairs with the target DNA, Cas9 cuts both strands, and the cell repairs the break. Repair by error-prone joining can disable the gene, and repair using a supplied template can introduce a precise change. The first CRISPR-based medicine, for sickle-cell disease and beta-thalassemia, was approved in the UK and the US in late 2023.

CRISPR is faster, cheaper and more precise than earlier methods of gene editing, and it has transformed research and begun to enter medicine. This guide explains the natural origin of CRISPR, how Cas9 works step by step, gene therapy and editing applications, limitations and ethical issues, works through a target-site design example and corrects common mistakes.

Where does CRISPR come from?

CRISPR stands for “clustered regularly interspaced short palindromic repeats”. These are repeated DNA sequences found in the genomes of many bacteria and archaea, separated by unique “spacer” sequences. The spacers are pieces of DNA from viruses (bacteriophages) that attacked the cell or its ancestors, so they are a molecular record of past infections. When the virus infects again, the cell makes RNA copies of the spacers. These guide the Cas (CRISPR-associated) enzymes to the matching viral DNA, which the enzyme cuts and destroys. It is a form of adaptive immunity in prokaryotes. Yogurt manufacturers first used the system in the 2000s to make their bacterial starter cultures resistant to phages.

How does CRISPR-Cas9 work?

1. Design the guide RNA (gRNA): a sequence of about 20 nucleotides is chosen to match the target site in the genome. In the lab, it is joined to a scaffold sequence to form a single guide RNA (sgRNA).
2. Form the complex: the sgRNA binds to the Cas9 enzyme (most commonly from Streptococcus pyogenes).
3. Find the target: the complex scans the DNA. Cas9 first recognizes a short sequence next to the target, called the PAM (protospacer adjacent motif), which is NGG for the commonly used Cas9 (N is any base). The PAM ensures that bacterial CRISPR does not cut its own spacers.
4. Pair and cut: if the 20 bases of the guide pair with the DNA next to the PAM, Cas9 unwinds the DNA and cuts both strands, making a double-strand break, about three bases upstream of the PAM.
5. Repair: the cell’s own repair machinery fixes the break, and the outcome depends on the method of repair.

The system can be delivered into cells as DNA, RNA or as a ready-made protein-RNA complex, using plasmids, viruses, lipid nanoparticles or microinjection. Changing the target requires only a new guide RNA, which can be ordered and made in days, unlike earlier tools (zinc-finger nucleases and TALENs), which needed new proteins to be engineered for each target.

How does the cell repair the cut?

• Non-homologous end joining (NHEJ): the cut ends are joined directly and quickly, but with errors. Small insertions or deletions (indels) often appear at the site. If their size is not a multiple of three, a frameshift results, and the gene is usually knocked out (disabled).
• Homology-directed repair (HDR): if a DNA template with matching ends is supplied together with the CRISPR components, the cell can copy the template into the break and introduce a precise change or insert a new gene. HDR is less efficient and works mainly in dividing cells.

Newer versions, called base editors and prime editors, change single DNA letters, or make small insertions and deletions, without making double-strand breaks, which gives more precision. Other variants use a disabled Cas9 (dCas9) to switch genes on or off without changing the DNA sequence (CRISPRi/CRISPRa), and Cas13 targets RNA.

Genome-editing methods compared

What are gene therapy and its uses?

Gene therapy treats or prevents disease by changing a person’s genes. In somatic gene therapy, cells of the body are changed, and the changes are not passed to children. In germline editing of embryos, eggs or sperm, the changes are inherited, which raises serious ethical issues, and is prohibited or restricted in many countries.

• Blood disorders: in the therapy approved for sickle-cell disease and beta-thalassemia (exagamglogene autotemcel, Casgevy), stem cells are taken from the patient’s blood, edited with CRISPR to switch on the production of fetal hemoglobin, and returned after the patient receives chemotherapy to make space.
• Other approaches: viral vectors that deliver a working copy of a gene, such as for some inherited eye diseases and spinal muscular atrophy; modified immune cells (CAR-T cells) for cancers; and in-body editing trials for cholesterol and liver diseases.
• Agriculture: crops with disease resistance, longer shelf life or better nutrition, and livestock resistant to certain viruses. Regulations for edited organisms without foreign DNA are different in different countries.
• Research: creating disease models and finding gene function.
• Ecology: “gene drives”, which spread a trait quickly through a wild population, are being studied to reduce disease-carrying mosquitoes, but they have not been released and raise questions about ecological effects.

Worked example: designing a guide and target

A researcher wants to knock out a gene. A short section of the target strand reads (5′ to 3′, 58 bases): ATGCGTACCTGATCGATTACGCGTAGCTAGGATCCAGTTCAGACGGTTAACCGATTGA. Find possible target sites for SpCas9, which needs a 20-nucleotide target immediately followed by the PAM NGG.

1. Find the PAMs: scan for any base followed by GG. The first is AGG at positions 29 to 31 (…GTAGCTAGGATCC…). The second is CGG at positions 44 to 46 (…TTCAGACGGTTAAC…).
2. Count 20 bases before each PAM: for the AGG at 29 to 31, the target is positions 9 to 28: CTGATCGATTACGCGTAGCT. For the CGG at 44 to 46, the target is positions 24 to 43: TAGCTAGGATCCAGTTCAGA.
3. Write the guide RNA for the first target. The guide has the same sequence as the target strand, with U in place of T, so that it pairs with the complementary DNA strand: 5′-CUGAUCGAUUACGCGUAGCU-3′.
4. Predict the cut: Cas9 cuts three base pairs before the PAM, between positions 25 and 26 (between the 17th and 18th bases of the target).
5. Predict the effect of an indel: if repair by NHEJ deleted 1 base at the cut, the number of bases removed is not a multiple of 3, so the reading frame of the gene shifts and the protein is probably non-functional. A deletion of 3 bases would remove one amino acid and keep the frame, so the gene might still work.

In practice researchers use software to list all NGG sites, rank them by predicted activity and check the rest of the genome for similar 20-base sequences (off-target sites). The guide should be unique, and the cut should be near the start of the coding sequence, so a frameshift has the biggest effect.

What are the limitations and ethical issues?

• Off-target effects: Cas9 may cut at similar sequences elsewhere. Improved enzymes and careful design reduce them.
• Delivery: getting the editing components into the right cells of the body is still challenging.
• Mosaicism and unintended large edits: not all cells are edited in the same way, and large deletions can occur.
• Cost and access: the first approved therapies cost millions of dollars per patient, raising issues of fairness.
• Germline editing: in 2018, He Jiankui announced the birth of twin girls whose embryos had been edited, in an experiment that was widely condemned as unethical and premature, and he was imprisoned in China. Most scientists support a moratorium on clinical germline editing until safety and ethical questions are resolved.
• Enhancement versus treatment: where to draw the line between treating disease and changing traits.
• Environmental release: the effects of edited organisms and gene drives on ecosystems.

How was CRISPR developed?

Yoshizumi Ishino first described the repeated sequences in E. coli in 1987. Francisco Mojica recognized in the 1990s and early 2000s that they are part of an immune system. Rodolphe Barrangou and Philippe Horvath showed in 2007 that the system gives resistance to phages. Emmanuelle Charpentier and Jennifer Doudna showed in 2012 that Cas9 can be programmed with a guide RNA to cut any DNA, and Feng Zhang and George Church applied it to human cells in 2013. Charpentier and Doudna received the Nobel Prize in Chemistry in 2020.

Which mistakes are common?

Mistake 1: Saying that Cas9 is the guide

Cas9 is the enzyme that cuts. The guide RNA specifies the location.

Mistake 2: Forgetting the PAM

The target must be next to a PAM sequence, or Cas9 will not cut.

Mistake 3: Thinking that a cut always gives a precise change

The cell’s repair often produces random small insertions or deletions. A precise change needs a template or a base editor.

Mistake 4: Assuming that gene therapy changes all the cells in the body

Most therapies modify a certain tissue, and somatic changes are not inherited.